ID: 940291171

View in Genome Browser
Species Human (GRCh38)
Location 2:152078924-152078946
Sequence AGACATGGTGGACCACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940291171_940291176 18 Left 940291171 2:152078924-152078946 CCAGTGTGTGGTCCACCATGTCT No data
Right 940291176 2:152078965-152078987 GCAAACAGTAATGTTCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940291171 Original CRISPR AGACATGGTGGACCACACAC TGG (reversed) Intronic
No off target data available for this crispr