ID: 940293559

View in Genome Browser
Species Human (GRCh38)
Location 2:152099617-152099639
Sequence GCTGCGAGTCACACACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940293557_940293559 15 Left 940293557 2:152099579-152099601 CCGTGTTTTTGTATTGCTTTGGC 0: 1
1: 0
2: 2
3: 35
4: 449
Right 940293559 2:152099617-152099639 GCTGCGAGTCACACACATCCAGG 0: 1
1: 0
2: 1
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940293559 Original CRISPR GCTGCGAGTCACACACATCC AGG Intergenic
900791087 1:4681397-4681419 GCTGCCAGCCACACCCACCCTGG + Intronic
901327843 1:8379641-8379663 GCTGCCAGTCCCACACTTCCTGG - Intronic
915252937 1:154603449-154603471 GCTGCCAGCTCCACACATCCAGG - Intronic
921172489 1:212561642-212561664 GCAGCGAGACACACATAGCCTGG + Intergenic
921714442 1:218403340-218403362 GCTGAGAGTCACACATATATAGG + Intronic
922629775 1:227094542-227094564 GCTGCCAGGAACACACTTCCAGG - Intronic
1067734895 10:48842814-48842836 CCTGCCAGTCACACTCTTCCTGG + Intronic
1071000844 10:80828672-80828694 GCTGGGAGGCACATACATCTGGG + Intergenic
1074942002 10:118245287-118245309 GCTGAGAGCCACACACACACAGG - Intergenic
1076322640 10:129594859-129594881 CCTGCGAGTTACACACATCCAGG + Intronic
1076829567 10:132987475-132987497 GCTGAGATTCTCACACATGCTGG - Intergenic
1077120831 11:907663-907685 GCTGAGAGGCCCACACAGCCTGG + Intronic
1078509448 11:11974704-11974726 GCTGCGAGTCAAGCACGTGCTGG - Intronic
1080919076 11:36690513-36690535 GCTGCGTATCACAGTCATCCAGG + Intergenic
1083364392 11:62132762-62132784 GCTGGGAGTCAGACAGACCCAGG - Intronic
1084398041 11:68927429-68927451 GCTGAGAGTCACAAACAGCCTGG - Intronic
1084815383 11:71642809-71642831 GCTGTGGGTCAGACACACCCTGG - Intergenic
1092427632 12:8387240-8387262 GCTGTGGGTCAGACACACCCTGG + Intergenic
1092428898 12:8394221-8394243 GCTGTGGGTCAGACACACCCTGG + Intergenic
1096706301 12:53424505-53424527 GGTGGGAGACAGACACATCCTGG + Intronic
1097156469 12:57015764-57015786 GCTGCTATTCACAGCCATCCTGG - Exonic
1100599395 12:96099877-96099899 GCTGGGAGACACAAACATTCAGG + Intergenic
1101612052 12:106301952-106301974 CCTTGGAGTCACACCCATCCAGG - Intronic
1101914054 12:108882739-108882761 GCTGAGAGTCAGACAGACCCAGG - Intronic
1106665732 13:31848396-31848418 GCAGGGAGTCAAACAGATCCAGG - Intergenic
1117124699 14:52609787-52609809 GCTGGGAGGCACACCCATCTGGG - Intronic
1119431906 14:74573960-74573982 GCCACGAGTCAGACAGATCCCGG - Intronic
1125769452 15:42155529-42155551 GCTGAGGGCCACAAACATCCGGG - Exonic
1127218588 15:56851719-56851741 GCTGGAAGTCACACACTTTCTGG + Intronic
1133370616 16:5243138-5243160 GCTGTGGGTCAGACACACCCTGG - Intergenic
1140477764 16:75247476-75247498 GCTGCGGGTGACACACGTCAGGG + Intronic
1141571830 16:84938822-84938844 GCTGTGAGCCACCCACAGCCTGG + Intergenic
1142744024 17:1946157-1946179 ACTGAAAGTCCCACACATCCTGG - Intronic
1143635747 17:8162980-8163002 GCCGCGCGTCACCCGCATCCGGG + Intronic
1148089751 17:45016209-45016231 GCTGCCACTCACATACATCAGGG + Intergenic
1152392447 17:80010701-80010723 GCTGGGAGCCACCCTCATCCTGG - Exonic
1155223036 18:23702644-23702666 CCTGTGAGTCAGACACAACCAGG - Intronic
1157307933 18:46530507-46530529 GCTGGGAGTGGCACTCATCCTGG + Intronic
1160566037 18:79787317-79787339 GCCGCGTGTCGCACACATCCCGG + Intergenic
1161421911 19:4180703-4180725 CCTGCGAGCCACACACATCTGGG - Intronic
1162576536 19:11502555-11502577 ACTACAAGTCACACACAGCCTGG - Intronic
1166867957 19:45852466-45852488 TCTGTCAGTCACTCACATCCAGG + Exonic
1167087409 19:47319873-47319895 GCTGCGTGTTCCAGACATCCTGG + Exonic
1167704069 19:51068016-51068038 GCTGAAAGTCACACACAAACTGG + Intergenic
1168410234 19:56135327-56135349 ACAGCAAGTCACACATATCCGGG - Intronic
925201176 2:1968778-1968800 GCTGCACGGCACACACAGCCAGG + Intronic
926077108 2:9950956-9950978 GCTGCGGGGCACAGACATCGCGG + Intergenic
928929495 2:36609916-36609938 GGTGAGACTCACAGACATCCGGG - Intronic
929313729 2:40453143-40453165 GCTGCGCATCACACACACCTGGG + Intronic
932302583 2:70677657-70677679 TCAGCGAGTCAGGCACATCCTGG + Intronic
932573836 2:72951962-72951984 GTTCCGACACACACACATCCAGG + Intronic
933985152 2:87584567-87584589 GAAGCAAGTCTCACACATCCGGG - Intergenic
936308690 2:111366244-111366266 GAAGCAAGTCTCACACATCCGGG + Intergenic
937883435 2:126884944-126884966 GCTGTGGGCCACACACATCATGG + Intergenic
940293559 2:152099617-152099639 GCTGCGAGTCACACACATCCAGG + Intergenic
945013962 2:205494787-205494809 GTTGGGAGTCACACAAATCCTGG + Intronic
1170896608 20:20420577-20420599 GCTGGGTGACACACACACCCTGG + Intronic
1174837574 20:53872821-53872843 CCTGTGAGTCTCCCACATCCTGG - Intergenic
1174930292 20:54806060-54806082 GCTGTGAGTCAGACATATCCAGG + Intergenic
1176137824 20:63532613-63532635 GCTGCGGCACAAACACATCCTGG - Exonic
1179183217 21:39062450-39062472 GCTGAGAGTCACACACAGTGTGG + Intergenic
1180230822 21:46425901-46425923 GCGGCGAGCCACACCCACCCCGG + Exonic
955232606 3:57112361-57112383 GCTGAGAGCCAGACACTTCCTGG - Intronic
955829005 3:62981557-62981579 GCTGCCAAACACACACATACTGG + Intergenic
957072329 3:75576934-75576956 GCTGTGGGTCAGACACACCCTGG + Intergenic
959428354 3:106221018-106221040 GCTGTGAGTCTGTCACATCCTGG + Intergenic
961281740 3:125769837-125769859 GCTGTGGGTCAGACACACCCTGG - Intergenic
961872605 3:129999747-129999769 GCTGTGGGTCAGACACACCCTGG + Intergenic
965470154 3:169080454-169080476 GCTGAGAGTCTCAGACCTCCTGG - Intergenic
968877444 4:3280435-3280457 GCTGTGGCTCACACACAGCCAGG - Intergenic
969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG + Intronic
969738030 4:9004103-9004125 GCTGTGGGTCAGACACACCCTGG - Intergenic
969797220 4:9535650-9535672 GCTGTGGGTCAGACACACCCTGG - Intergenic
970116459 4:12702162-12702184 GCTGCGGGACACAGAGATCCTGG + Intergenic
970172872 4:13306575-13306597 GCTGGGAGTCACACCCTGCCTGG - Intergenic
979095449 4:116544174-116544196 GGTGCAAGTAACACACATCATGG + Intergenic
985759043 5:1735379-1735401 GCTGCGCGTTACACTCACCCTGG + Intergenic
988509821 5:31855441-31855463 CCTGCCCGTCACACACAGCCGGG - Intronic
991650576 5:68848316-68848338 GCTGGGAGTCACAGACATTGTGG + Intergenic
993128920 5:83871657-83871679 GTTGCTAGTCACCCACATCTAGG + Intergenic
1001042653 5:168348100-168348122 GCTGCCAGTAACACCCATCTCGG - Intronic
1002560092 5:180075514-180075536 GCTGCCAGCCTCCCACATCCAGG + Intergenic
1003045319 6:2728468-2728490 GCTGCGGGACACAGAGATCCTGG - Intronic
1011103869 6:83757760-83757782 GCTGGGAGGCACACCCATCTGGG - Intergenic
1013651423 6:112198985-112199007 GCTGAGATTCACACTCACCCAGG + Intronic
1018174750 6:161168814-161168836 TTTGGGAGTCAGACACATCCAGG + Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1023872270 7:44269526-44269548 GCTGTGAGTCACCCACTGCCAGG - Intronic
1035610197 8:956982-957004 GCTCCAAGACACACACATCAGGG + Intergenic
1036243114 8:7095377-7095399 GCTGTGGGTCAGACACACCCTGG - Intergenic
1036358540 8:8061845-8061867 GCTGTGGGTCAGACACACCCTGG - Intergenic
1036891157 8:12598114-12598136 GCTGTGGGTCAGACACACCCTGG + Intergenic
1036898713 8:12656054-12656076 GCTGTGGGTCAGACACACCCTGG + Intergenic
1036899964 8:12663083-12663105 GCTGTGGGTCAGACACACCCTGG + Intergenic
1038494193 8:27990129-27990151 GCTGCCCTTCACACACATTCTGG - Intronic
1039549138 8:38430481-38430503 TCTCCGAATCACACGCATCCTGG - Intronic
1042345820 8:67726789-67726811 GCTGCGTGTCACATAGATACTGG - Intronic
1044693864 8:94903875-94903897 GCTGCCTGCCCCACACATCCTGG - Intronic
1054763985 9:69027330-69027352 GTGGCCAGGCACACACATCCAGG - Intergenic
1059505915 9:114799805-114799827 GCTGTGAATCTCAGACATCCAGG - Intronic
1060067761 9:120518501-120518523 GCTGCAAGTCACTCAGCTCCTGG + Exonic
1061587342 9:131577526-131577548 CCTGCGAGTCTCACAAATACAGG + Exonic
1062053921 9:134461044-134461066 GCTGACAGCCACACCCATCCAGG - Intergenic
1062298479 9:135848660-135848682 GCTGTGGCTCACACACACCCAGG + Intronic
1201175791 Y:11307714-11307736 GCTGCGGGTCACAGCCCTCCCGG - Intergenic