ID: 940298550

View in Genome Browser
Species Human (GRCh38)
Location 2:152155375-152155397
Sequence CTCAGCAGTGAAGCTTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940298550_940298554 5 Left 940298550 2:152155375-152155397 CCAACCAAAGCTTCACTGCTGAG No data
Right 940298554 2:152155403-152155425 AAATATTCAACGGGCTACATAGG No data
940298550_940298553 -4 Left 940298550 2:152155375-152155397 CCAACCAAAGCTTCACTGCTGAG No data
Right 940298553 2:152155394-152155416 TGAGCATACAAATATTCAACGGG No data
940298550_940298552 -5 Left 940298550 2:152155375-152155397 CCAACCAAAGCTTCACTGCTGAG No data
Right 940298552 2:152155393-152155415 CTGAGCATACAAATATTCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940298550 Original CRISPR CTCAGCAGTGAAGCTTTGGT TGG (reversed) Intronic
No off target data available for this crispr