ID: 940298551

View in Genome Browser
Species Human (GRCh38)
Location 2:152155379-152155401
Sequence TATGCTCAGCAGTGAAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940298551_940298552 -9 Left 940298551 2:152155379-152155401 CCAAAGCTTCACTGCTGAGCATA No data
Right 940298552 2:152155393-152155415 CTGAGCATACAAATATTCAACGG No data
940298551_940298554 1 Left 940298551 2:152155379-152155401 CCAAAGCTTCACTGCTGAGCATA No data
Right 940298554 2:152155403-152155425 AAATATTCAACGGGCTACATAGG No data
940298551_940298553 -8 Left 940298551 2:152155379-152155401 CCAAAGCTTCACTGCTGAGCATA No data
Right 940298553 2:152155394-152155416 TGAGCATACAAATATTCAACGGG No data
940298551_940298555 29 Left 940298551 2:152155379-152155401 CCAAAGCTTCACTGCTGAGCATA No data
Right 940298555 2:152155431-152155453 ACTTCAATAGCAACACCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940298551 Original CRISPR TATGCTCAGCAGTGAAGCTT TGG (reversed) Intronic
No off target data available for this crispr