ID: 940298554

View in Genome Browser
Species Human (GRCh38)
Location 2:152155403-152155425
Sequence AAATATTCAACGGGCTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940298550_940298554 5 Left 940298550 2:152155375-152155397 CCAACCAAAGCTTCACTGCTGAG No data
Right 940298554 2:152155403-152155425 AAATATTCAACGGGCTACATAGG No data
940298551_940298554 1 Left 940298551 2:152155379-152155401 CCAAAGCTTCACTGCTGAGCATA No data
Right 940298554 2:152155403-152155425 AAATATTCAACGGGCTACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940298554 Original CRISPR AAATATTCAACGGGCTACAT AGG Intronic
No off target data available for this crispr