ID: 940298555

View in Genome Browser
Species Human (GRCh38)
Location 2:152155431-152155453
Sequence ACTTCAATAGCAACACCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940298551_940298555 29 Left 940298551 2:152155379-152155401 CCAAAGCTTCACTGCTGAGCATA No data
Right 940298555 2:152155431-152155453 ACTTCAATAGCAACACCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940298555 Original CRISPR ACTTCAATAGCAACACCACA TGG Intronic
No off target data available for this crispr