ID: 940301011

View in Genome Browser
Species Human (GRCh38)
Location 2:152176223-152176245
Sequence TCTCAAAGCCACCTCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940301011 Original CRISPR TCTCAAAGCCACCTCCGCGC CGG (reversed) Intergenic
901872102 1:12144256-12144278 TCCCAAAGCCACTTCTGCTCAGG - Intergenic
904601395 1:31674548-31674570 TCTCAAATCCATCTCCTCCCTGG + Intronic
904795877 1:33056027-33056049 TCTCAAAGTCCCCTCCCCCCTGG + Intronic
906607126 1:47180416-47180438 TTTCAAAGCCAACTCCTGGCTGG + Intergenic
907429359 1:54403144-54403166 ACTCAAAGCCACCACCGCCCGGG + Intronic
914365918 1:146977887-146977909 TCTCATAGTCACCTCAGTGCAGG + Intronic
914486526 1:148115555-148115577 TCTCATAGTCACCTCAGTGCAGG - Intronic
922110037 1:222547643-222547665 TCCCAAAGCACCCTCCGCTCAGG + Intronic
1063088663 10:2842055-2842077 TCTCAAATCCATCTCCCCGGTGG - Intergenic
1068874946 10:61986035-61986057 TCTCAAAGCCACCAGCCCACTGG + Intronic
1070990807 10:80730616-80730638 GCTCAAAGCCACCTCCTCTGTGG + Intergenic
1073357827 10:102870945-102870967 TCTCAAATACACCTACGCGGCGG + Intronic
1076224365 10:128762188-128762210 TCCCAAAGCCACCCCAGAGCAGG - Intergenic
1081207767 11:40294294-40294316 TCTAAAAGCAACCCCCACGCTGG + Intronic
1082620238 11:55411508-55411530 TCACAGAGCCACCTCCCAGCAGG - Intergenic
1092154795 12:6275106-6275128 CCTCAAACCCACCTCCATGCTGG + Intergenic
1094408504 12:30145188-30145210 TCTCAAAGGCACCTTCTCACAGG - Intergenic
1102236596 12:111297927-111297949 TCTGAAAGCCACCTCCTCCAGGG - Intronic
1113569268 13:111342333-111342355 TCCCAAAGACAGCTCCGGGCAGG - Intronic
1117029068 14:51651337-51651359 TCACGAAGCCACCTCCGCCGGGG + Intronic
1121286139 14:92737402-92737424 TCTCAAGGCAACCTCCTGGCAGG - Intronic
1121439647 14:93940598-93940620 TCTCAACGCCTCCTCCCCGAAGG + Intronic
1121470060 14:94145908-94145930 GCTCAAAACCACCTCCCCTCAGG - Intergenic
1122538027 14:102479839-102479861 TCTCCAAGGCACCTGCGTGCAGG - Intronic
1125728275 15:41879231-41879253 TCCCAATGCCACCACTGCGCTGG + Intronic
1128727454 15:69998692-69998714 TCTCAAAGCCCCCTCTCCTCCGG - Intergenic
1129162497 15:73754237-73754259 TATCAAAGCTCCCTCCGCCCCGG - Intergenic
1129513946 15:76145072-76145094 TCTCAAAGCCACCCTTGCCCTGG - Intronic
1129671690 15:77611168-77611190 TCTCAGAGCCACTTCTGGGCAGG - Intergenic
1141922972 16:87148390-87148412 TTTCAAAGCCAACTCCATGCTGG - Intronic
1142262073 16:89047779-89047801 TCTCCAAGCCCTCCCCGCGCTGG - Intergenic
1142355768 16:89601070-89601092 TCTCAAATCCACCCCCGAGGAGG - Intergenic
1143675132 17:8426944-8426966 TCTAAAAGCCACCTTCCAGCAGG + Intronic
1148328125 17:46795730-46795752 TCTCAAAGCCAGCCCCACCCGGG + Intronic
1148788090 17:50155739-50155761 CCCCAAAGCCACCTGCGTGCTGG - Intergenic
1151798813 17:76365226-76365248 TCTCACAGCAACCTCCAGGCAGG - Intronic
1152699358 17:81811458-81811480 GCTGAAAGCCAGCTCCGTGCTGG + Exonic
1158427341 18:57352260-57352282 CCCCACAGCCACCTCCTCGCCGG + Exonic
1159112857 18:64079810-64079832 TCTCAAATCCACCTCCCTGATGG - Intergenic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
926609873 2:14936038-14936060 TCTCCATGCCATCTCCACGCTGG + Intergenic
929368537 2:41192372-41192394 TCTGAAAGCAACCTCCACCCCGG - Intergenic
934735222 2:96686558-96686580 CCCCAAATCCACCTCCTCGCTGG + Intergenic
935296432 2:101653649-101653671 TCTCAAATCCACCTCCCTGATGG - Intergenic
940301011 2:152176223-152176245 TCTCAAAGCCACCTCCGCGCCGG - Intergenic
942360553 2:175167848-175167870 TCCCAAAGCCCACACCGCGCGGG + Intronic
1175165236 20:57038883-57038905 TGTCAGAGCCACCTCCAGGCTGG - Intergenic
1180059195 21:45375919-45375941 TCTCCAGGCCACCTCCACGCAGG - Intergenic
1180114832 21:45695424-45695446 TCTCACAGGCACCTCAGCACTGG + Intronic
1182067819 22:27442924-27442946 CCTCTAAGCCACCTCCCCTCTGG - Intergenic
1185373626 22:50472018-50472040 TCTCAAAGACACCTCAGCACTGG + Intronic
950829571 3:15860076-15860098 TCCCCACGCCACCTCCGCCCCGG - Intergenic
954754022 3:52829312-52829334 TTTCAATGCCACCTCAGCTCGGG + Intronic
954810605 3:53245005-53245027 TCTTAAAGCCCCCTCCAGGCTGG + Intronic
971072995 4:23115621-23115643 GTTCAAAGCCACCTCCTCACTGG - Intergenic
983292838 4:165827524-165827546 TTCCAAAGTCACCTCAGCGCTGG - Intergenic
983729046 4:170971043-170971065 GCTCACAGCCACCTCCGCTGTGG - Intergenic
985628407 5:1002103-1002125 TCACAAAGCGACCTCGGCTCAGG - Intergenic
987404615 5:17512193-17512215 CCTCAAAGCCACCGCCTGGCAGG - Intergenic
993171985 5:84431041-84431063 TGTAAAAGCCACCTCCTGGCTGG - Intergenic
997852088 5:137342142-137342164 TCAGAAAGACACCTCCGCGGAGG + Intronic
997943494 5:138179245-138179267 TCTTAAAGCCTATTCCGCGCGGG - Intronic
998271590 5:140711259-140711281 TCCGAAAGCAACCTCCGGGCTGG + Intergenic
1001395362 5:171415617-171415639 TCTCAAAGCCAGCTCCTAGAAGG - Intergenic
1002399180 5:178981698-178981720 CCTCAAGGCCACCTCCACGGTGG - Exonic
1005891068 6:30138795-30138817 TCTCAAAGCTACCTCAGCTTTGG - Intronic
1007636137 6:43300932-43300954 TTTAAAAGCCACCTCTGGGCTGG - Intronic
1022797004 7:33739770-33739792 TCTCCGAGCCACCTCCCTGCTGG - Intergenic
1023583526 7:41705761-41705783 TCACAAACCCAACTCCACGCTGG + Intergenic
1026941203 7:74289165-74289187 GCCCACATCCACCTCCGCGCTGG - Intergenic
1029803177 7:102971519-102971541 GCTCACCGCCACCTCCGCCCGGG - Intronic
1030820554 7:114086662-114086684 TGTCCCAGCCACCTCCACGCTGG + Intronic
1038370256 8:26981914-26981936 TCTCCAACCAACCTCCGCACTGG + Intergenic
1045288454 8:100811790-100811812 TCACACAGCCACCTCCACCCTGG - Intergenic
1049449892 8:142654974-142654996 CCTCAAAGCCACCTTGGGGCAGG - Intergenic
1052420362 9:28235270-28235292 TCTCAAAGGTACCTCCTTGCTGG - Intronic
1061458638 9:130717937-130717959 TCTCAATGCAACCTCCGCTCCGG - Intronic
1061863507 9:133479536-133479558 TCTCAGGGCCACCTCTGCCCTGG + Intergenic
1186904437 X:14096296-14096318 TCTCAAAGCCACCACTGCTAAGG + Intergenic
1194041966 X:88952298-88952320 TCTCAAAGCAACCTCCTGGTGGG - Intergenic
1195078442 X:101348946-101348968 TCTCAACGGCACCTCGGCTCTGG - Exonic
1200075079 X:153546816-153546838 TCCCAAACCCAGCTCCGCACAGG - Intronic