ID: 940301964

View in Genome Browser
Species Human (GRCh38)
Location 2:152184801-152184823
Sequence CAAACTACTGCCCTCAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940301964_940301968 3 Left 940301964 2:152184801-152184823 CCAATTTTGAGGGCAGTAGTTTG No data
Right 940301968 2:152184827-152184849 TGTGACCTTAGCTCTCTACTGGG No data
940301964_940301967 2 Left 940301964 2:152184801-152184823 CCAATTTTGAGGGCAGTAGTTTG No data
Right 940301967 2:152184826-152184848 CTGTGACCTTAGCTCTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940301964 Original CRISPR CAAACTACTGCCCTCAAAAT TGG (reversed) Intergenic
No off target data available for this crispr