ID: 940301968

View in Genome Browser
Species Human (GRCh38)
Location 2:152184827-152184849
Sequence TGTGACCTTAGCTCTCTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940301961_940301968 24 Left 940301961 2:152184780-152184802 CCTCTGTATCTATCTATCTCTCC No data
Right 940301968 2:152184827-152184849 TGTGACCTTAGCTCTCTACTGGG No data
940301964_940301968 3 Left 940301964 2:152184801-152184823 CCAATTTTGAGGGCAGTAGTTTG No data
Right 940301968 2:152184827-152184849 TGTGACCTTAGCTCTCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940301968 Original CRISPR TGTGACCTTAGCTCTCTACT GGG Intergenic
No off target data available for this crispr