ID: 940306707

View in Genome Browser
Species Human (GRCh38)
Location 2:152234821-152234843
Sequence ATCCTCAGTCTTGAATAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940306703_940306707 6 Left 940306703 2:152234792-152234814 CCTAGATATTCATAAATGTACCC No data
Right 940306707 2:152234821-152234843 ATCCTCAGTCTTGAATAAGGTGG No data
940306701_940306707 26 Left 940306701 2:152234772-152234794 CCCATTTGGACAAACTTGGACCT No data
Right 940306707 2:152234821-152234843 ATCCTCAGTCTTGAATAAGGTGG No data
940306702_940306707 25 Left 940306702 2:152234773-152234795 CCATTTGGACAAACTTGGACCTA No data
Right 940306707 2:152234821-152234843 ATCCTCAGTCTTGAATAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940306707 Original CRISPR ATCCTCAGTCTTGAATAAGG TGG Intergenic