ID: 940324704

View in Genome Browser
Species Human (GRCh38)
Location 2:152412906-152412928
Sequence CTGCTGTTATAGGTCAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940324701_940324704 3 Left 940324701 2:152412880-152412902 CCATTAGTTTGGACCATATGAAC No data
Right 940324704 2:152412906-152412928 CTGCTGTTATAGGTCAGAAATGG No data
940324699_940324704 27 Left 940324699 2:152412856-152412878 CCAAGTAGTCAAGTATTTCTGTT No data
Right 940324704 2:152412906-152412928 CTGCTGTTATAGGTCAGAAATGG No data
940324702_940324704 -10 Left 940324702 2:152412893-152412915 CCATATGAACTTGCTGCTGTTAT No data
Right 940324704 2:152412906-152412928 CTGCTGTTATAGGTCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940324704 Original CRISPR CTGCTGTTATAGGTCAGAAA TGG Intronic
No off target data available for this crispr