ID: 940326610

View in Genome Browser
Species Human (GRCh38)
Location 2:152432422-152432444
Sequence TATTGTTCTAAAGATGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940326608_940326610 -7 Left 940326608 2:152432406-152432428 CCATCCTAATTTACAGTATTGTT No data
Right 940326610 2:152432422-152432444 TATTGTTCTAAAGATGCACCAGG No data
940326606_940326610 18 Left 940326606 2:152432381-152432403 CCAGTTTTCTTAAGGTCTGATAC No data
Right 940326610 2:152432422-152432444 TATTGTTCTAAAGATGCACCAGG No data
940326607_940326610 -6 Left 940326607 2:152432405-152432427 CCCATCCTAATTTACAGTATTGT No data
Right 940326610 2:152432422-152432444 TATTGTTCTAAAGATGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940326610 Original CRISPR TATTGTTCTAAAGATGCACC AGG Intronic
No off target data available for this crispr