ID: 940335129

View in Genome Browser
Species Human (GRCh38)
Location 2:152518784-152518806
Sequence GCTTAGTCCTGGCCTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940335126_940335129 7 Left 940335126 2:152518754-152518776 CCATCTAAGCTGCCATCATTCAC No data
Right 940335129 2:152518784-152518806 GCTTAGTCCTGGCCTCCTACTGG No data
940335123_940335129 16 Left 940335123 2:152518745-152518767 CCATCGACCCCATCTAAGCTGCC No data
Right 940335129 2:152518784-152518806 GCTTAGTCCTGGCCTCCTACTGG No data
940335125_940335129 8 Left 940335125 2:152518753-152518775 CCCATCTAAGCTGCCATCATTCA No data
Right 940335129 2:152518784-152518806 GCTTAGTCCTGGCCTCCTACTGG No data
940335127_940335129 -5 Left 940335127 2:152518766-152518788 CCATCATTCACTTGAACTGCTTA No data
Right 940335129 2:152518784-152518806 GCTTAGTCCTGGCCTCCTACTGG No data
940335124_940335129 9 Left 940335124 2:152518752-152518774 CCCCATCTAAGCTGCCATCATTC No data
Right 940335129 2:152518784-152518806 GCTTAGTCCTGGCCTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940335129 Original CRISPR GCTTAGTCCTGGCCTCCTAC TGG Intronic
No off target data available for this crispr