ID: 940337514

View in Genome Browser
Species Human (GRCh38)
Location 2:152544751-152544773
Sequence GGGCCTAAGCAGCACTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940337514_940337527 25 Left 940337514 2:152544751-152544773 CCTAGGGAGTGCTGCTTAGGCCC No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data
940337514_940337528 26 Left 940337514 2:152544751-152544773 CCTAGGGAGTGCTGCTTAGGCCC No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data
940337514_940337517 -2 Left 940337514 2:152544751-152544773 CCTAGGGAGTGCTGCTTAGGCCC No data
Right 940337517 2:152544772-152544794 CCCCACTTCCATACCCCACATGG No data
940337514_940337525 16 Left 940337514 2:152544751-152544773 CCTAGGGAGTGCTGCTTAGGCCC No data
Right 940337525 2:152544790-152544812 CATGGAGGAAGATGCTTAGAAGG No data
940337514_940337526 22 Left 940337514 2:152544751-152544773 CCTAGGGAGTGCTGCTTAGGCCC No data
Right 940337526 2:152544796-152544818 GGAAGATGCTTAGAAGGAAGAGG No data
940337514_940337520 1 Left 940337514 2:152544751-152544773 CCTAGGGAGTGCTGCTTAGGCCC No data
Right 940337520 2:152544775-152544797 CACTTCCATACCCCACATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940337514 Original CRISPR GGGCCTAAGCAGCACTCCCT AGG (reversed) Intronic