ID: 940337515

View in Genome Browser
Species Human (GRCh38)
Location 2:152544771-152544793
Sequence CATGTGGGGTATGGAAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940337515_940337526 2 Left 940337515 2:152544771-152544793 CCCCCACTTCCATACCCCACATG No data
Right 940337526 2:152544796-152544818 GGAAGATGCTTAGAAGGAAGAGG No data
940337515_940337527 5 Left 940337515 2:152544771-152544793 CCCCCACTTCCATACCCCACATG No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data
940337515_940337525 -4 Left 940337515 2:152544771-152544793 CCCCCACTTCCATACCCCACATG No data
Right 940337525 2:152544790-152544812 CATGGAGGAAGATGCTTAGAAGG No data
940337515_940337529 17 Left 940337515 2:152544771-152544793 CCCCCACTTCCATACCCCACATG No data
Right 940337529 2:152544811-152544833 GGAAGAGGTGGGCTTCCTCCTGG No data
940337515_940337528 6 Left 940337515 2:152544771-152544793 CCCCCACTTCCATACCCCACATG No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940337515 Original CRISPR CATGTGGGGTATGGAAGTGG GGG (reversed) Intronic