ID: 940337516

View in Genome Browser
Species Human (GRCh38)
Location 2:152544772-152544794
Sequence CCATGTGGGGTATGGAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940337516_940337525 -5 Left 940337516 2:152544772-152544794 CCCCACTTCCATACCCCACATGG No data
Right 940337525 2:152544790-152544812 CATGGAGGAAGATGCTTAGAAGG No data
940337516_940337528 5 Left 940337516 2:152544772-152544794 CCCCACTTCCATACCCCACATGG No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data
940337516_940337527 4 Left 940337516 2:152544772-152544794 CCCCACTTCCATACCCCACATGG No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data
940337516_940337529 16 Left 940337516 2:152544772-152544794 CCCCACTTCCATACCCCACATGG No data
Right 940337529 2:152544811-152544833 GGAAGAGGTGGGCTTCCTCCTGG No data
940337516_940337526 1 Left 940337516 2:152544772-152544794 CCCCACTTCCATACCCCACATGG No data
Right 940337526 2:152544796-152544818 GGAAGATGCTTAGAAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940337516 Original CRISPR CCATGTGGGGTATGGAAGTG GGG (reversed) Intronic