ID: 940337517

View in Genome Browser
Species Human (GRCh38)
Location 2:152544772-152544794
Sequence CCCCACTTCCATACCCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940337514_940337517 -2 Left 940337514 2:152544751-152544773 CCTAGGGAGTGCTGCTTAGGCCC No data
Right 940337517 2:152544772-152544794 CCCCACTTCCATACCCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940337517 Original CRISPR CCCCACTTCCATACCCCACA TGG Intronic