ID: 940337518

View in Genome Browser
Species Human (GRCh38)
Location 2:152544773-152544795
Sequence TCCATGTGGGGTATGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940337518_940337525 -6 Left 940337518 2:152544773-152544795 CCCACTTCCATACCCCACATGGA No data
Right 940337525 2:152544790-152544812 CATGGAGGAAGATGCTTAGAAGG No data
940337518_940337527 3 Left 940337518 2:152544773-152544795 CCCACTTCCATACCCCACATGGA No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data
940337518_940337529 15 Left 940337518 2:152544773-152544795 CCCACTTCCATACCCCACATGGA No data
Right 940337529 2:152544811-152544833 GGAAGAGGTGGGCTTCCTCCTGG No data
940337518_940337528 4 Left 940337518 2:152544773-152544795 CCCACTTCCATACCCCACATGGA No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data
940337518_940337526 0 Left 940337518 2:152544773-152544795 CCCACTTCCATACCCCACATGGA No data
Right 940337526 2:152544796-152544818 GGAAGATGCTTAGAAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940337518 Original CRISPR TCCATGTGGGGTATGGAAGT GGG (reversed) Intronic