ID: 940337520 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:152544775-152544797 |
| Sequence | CACTTCCATACCCCACATGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940337514_940337520 | 1 | Left | 940337514 | 2:152544751-152544773 | CCTAGGGAGTGCTGCTTAGGCCC | No data | ||
| Right | 940337520 | 2:152544775-152544797 | CACTTCCATACCCCACATGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940337520 | Original CRISPR | CACTTCCATACCCCACATGG AGG | Intronic | ||