ID: 940337521

View in Genome Browser
Species Human (GRCh38)
Location 2:152544780-152544802
Sequence ATCTTCCTCCATGTGGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940337521_940337529 8 Left 940337521 2:152544780-152544802 CCATACCCCACATGGAGGAAGAT No data
Right 940337529 2:152544811-152544833 GGAAGAGGTGGGCTTCCTCCTGG No data
940337521_940337527 -4 Left 940337521 2:152544780-152544802 CCATACCCCACATGGAGGAAGAT No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data
940337521_940337528 -3 Left 940337521 2:152544780-152544802 CCATACCCCACATGGAGGAAGAT No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data
940337521_940337526 -7 Left 940337521 2:152544780-152544802 CCATACCCCACATGGAGGAAGAT No data
Right 940337526 2:152544796-152544818 GGAAGATGCTTAGAAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940337521 Original CRISPR ATCTTCCTCCATGTGGGGTA TGG (reversed) Intronic