ID: 940337522

View in Genome Browser
Species Human (GRCh38)
Location 2:152544785-152544807
Sequence TAAGCATCTTCCTCCATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940337522_940337527 -9 Left 940337522 2:152544785-152544807 CCCCACATGGAGGAAGATGCTTA No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data
940337522_940337529 3 Left 940337522 2:152544785-152544807 CCCCACATGGAGGAAGATGCTTA No data
Right 940337529 2:152544811-152544833 GGAAGAGGTGGGCTTCCTCCTGG No data
940337522_940337528 -8 Left 940337522 2:152544785-152544807 CCCCACATGGAGGAAGATGCTTA No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940337522 Original CRISPR TAAGCATCTTCCTCCATGTG GGG (reversed) Intronic