ID: 940337525

View in Genome Browser
Species Human (GRCh38)
Location 2:152544790-152544812
Sequence CATGGAGGAAGATGCTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940337516_940337525 -5 Left 940337516 2:152544772-152544794 CCCCACTTCCATACCCCACATGG No data
Right 940337525 2:152544790-152544812 CATGGAGGAAGATGCTTAGAAGG No data
940337519_940337525 -7 Left 940337519 2:152544774-152544796 CCACTTCCATACCCCACATGGAG No data
Right 940337525 2:152544790-152544812 CATGGAGGAAGATGCTTAGAAGG No data
940337514_940337525 16 Left 940337514 2:152544751-152544773 CCTAGGGAGTGCTGCTTAGGCCC No data
Right 940337525 2:152544790-152544812 CATGGAGGAAGATGCTTAGAAGG No data
940337518_940337525 -6 Left 940337518 2:152544773-152544795 CCCACTTCCATACCCCACATGGA No data
Right 940337525 2:152544790-152544812 CATGGAGGAAGATGCTTAGAAGG No data
940337515_940337525 -4 Left 940337515 2:152544771-152544793 CCCCCACTTCCATACCCCACATG No data
Right 940337525 2:152544790-152544812 CATGGAGGAAGATGCTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940337525 Original CRISPR CATGGAGGAAGATGCTTAGA AGG Intronic