ID: 940337526

View in Genome Browser
Species Human (GRCh38)
Location 2:152544796-152544818
Sequence GGAAGATGCTTAGAAGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940337514_940337526 22 Left 940337514 2:152544751-152544773 CCTAGGGAGTGCTGCTTAGGCCC No data
Right 940337526 2:152544796-152544818 GGAAGATGCTTAGAAGGAAGAGG No data
940337516_940337526 1 Left 940337516 2:152544772-152544794 CCCCACTTCCATACCCCACATGG No data
Right 940337526 2:152544796-152544818 GGAAGATGCTTAGAAGGAAGAGG No data
940337519_940337526 -1 Left 940337519 2:152544774-152544796 CCACTTCCATACCCCACATGGAG No data
Right 940337526 2:152544796-152544818 GGAAGATGCTTAGAAGGAAGAGG No data
940337518_940337526 0 Left 940337518 2:152544773-152544795 CCCACTTCCATACCCCACATGGA No data
Right 940337526 2:152544796-152544818 GGAAGATGCTTAGAAGGAAGAGG No data
940337521_940337526 -7 Left 940337521 2:152544780-152544802 CCATACCCCACATGGAGGAAGAT No data
Right 940337526 2:152544796-152544818 GGAAGATGCTTAGAAGGAAGAGG No data
940337515_940337526 2 Left 940337515 2:152544771-152544793 CCCCCACTTCCATACCCCACATG No data
Right 940337526 2:152544796-152544818 GGAAGATGCTTAGAAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940337526 Original CRISPR GGAAGATGCTTAGAAGGAAG AGG Intronic