ID: 940337527

View in Genome Browser
Species Human (GRCh38)
Location 2:152544799-152544821
Sequence AGATGCTTAGAAGGAAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940337521_940337527 -4 Left 940337521 2:152544780-152544802 CCATACCCCACATGGAGGAAGAT No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data
940337523_940337527 -10 Left 940337523 2:152544786-152544808 CCCACATGGAGGAAGATGCTTAG No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data
940337518_940337527 3 Left 940337518 2:152544773-152544795 CCCACTTCCATACCCCACATGGA No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data
940337514_940337527 25 Left 940337514 2:152544751-152544773 CCTAGGGAGTGCTGCTTAGGCCC No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data
940337516_940337527 4 Left 940337516 2:152544772-152544794 CCCCACTTCCATACCCCACATGG No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data
940337522_940337527 -9 Left 940337522 2:152544785-152544807 CCCCACATGGAGGAAGATGCTTA No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data
940337519_940337527 2 Left 940337519 2:152544774-152544796 CCACTTCCATACCCCACATGGAG No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data
940337515_940337527 5 Left 940337515 2:152544771-152544793 CCCCCACTTCCATACCCCACATG No data
Right 940337527 2:152544799-152544821 AGATGCTTAGAAGGAAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940337527 Original CRISPR AGATGCTTAGAAGGAAGAGG TGG Intronic