ID: 940337528

View in Genome Browser
Species Human (GRCh38)
Location 2:152544800-152544822
Sequence GATGCTTAGAAGGAAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940337518_940337528 4 Left 940337518 2:152544773-152544795 CCCACTTCCATACCCCACATGGA No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data
940337523_940337528 -9 Left 940337523 2:152544786-152544808 CCCACATGGAGGAAGATGCTTAG No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data
940337515_940337528 6 Left 940337515 2:152544771-152544793 CCCCCACTTCCATACCCCACATG No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data
940337519_940337528 3 Left 940337519 2:152544774-152544796 CCACTTCCATACCCCACATGGAG No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data
940337514_940337528 26 Left 940337514 2:152544751-152544773 CCTAGGGAGTGCTGCTTAGGCCC No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data
940337516_940337528 5 Left 940337516 2:152544772-152544794 CCCCACTTCCATACCCCACATGG No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data
940337522_940337528 -8 Left 940337522 2:152544785-152544807 CCCCACATGGAGGAAGATGCTTA No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data
940337524_940337528 -10 Left 940337524 2:152544787-152544809 CCACATGGAGGAAGATGCTTAGA No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data
940337521_940337528 -3 Left 940337521 2:152544780-152544802 CCATACCCCACATGGAGGAAGAT No data
Right 940337528 2:152544800-152544822 GATGCTTAGAAGGAAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940337528 Original CRISPR GATGCTTAGAAGGAAGAGGT GGG Intronic