ID: 940337529

View in Genome Browser
Species Human (GRCh38)
Location 2:152544811-152544833
Sequence GGAAGAGGTGGGCTTCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940337522_940337529 3 Left 940337522 2:152544785-152544807 CCCCACATGGAGGAAGATGCTTA No data
Right 940337529 2:152544811-152544833 GGAAGAGGTGGGCTTCCTCCTGG No data
940337515_940337529 17 Left 940337515 2:152544771-152544793 CCCCCACTTCCATACCCCACATG No data
Right 940337529 2:152544811-152544833 GGAAGAGGTGGGCTTCCTCCTGG No data
940337524_940337529 1 Left 940337524 2:152544787-152544809 CCACATGGAGGAAGATGCTTAGA No data
Right 940337529 2:152544811-152544833 GGAAGAGGTGGGCTTCCTCCTGG No data
940337521_940337529 8 Left 940337521 2:152544780-152544802 CCATACCCCACATGGAGGAAGAT No data
Right 940337529 2:152544811-152544833 GGAAGAGGTGGGCTTCCTCCTGG No data
940337518_940337529 15 Left 940337518 2:152544773-152544795 CCCACTTCCATACCCCACATGGA No data
Right 940337529 2:152544811-152544833 GGAAGAGGTGGGCTTCCTCCTGG No data
940337519_940337529 14 Left 940337519 2:152544774-152544796 CCACTTCCATACCCCACATGGAG No data
Right 940337529 2:152544811-152544833 GGAAGAGGTGGGCTTCCTCCTGG No data
940337523_940337529 2 Left 940337523 2:152544786-152544808 CCCACATGGAGGAAGATGCTTAG No data
Right 940337529 2:152544811-152544833 GGAAGAGGTGGGCTTCCTCCTGG No data
940337516_940337529 16 Left 940337516 2:152544772-152544794 CCCCACTTCCATACCCCACATGG No data
Right 940337529 2:152544811-152544833 GGAAGAGGTGGGCTTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940337529 Original CRISPR GGAAGAGGTGGGCTTCCTCC TGG Intronic