ID: 940337532

View in Genome Browser
Species Human (GRCh38)
Location 2:152544841-152544863
Sequence CAGCTGATCTAAAGGAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940337532_940337536 -9 Left 940337532 2:152544841-152544863 CCAATTTTCCTTTAGATCAGCTG No data
Right 940337536 2:152544855-152544877 GATCAGCTGTTTCTGGGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940337532 Original CRISPR CAGCTGATCTAAAGGAAAAT TGG (reversed) Intronic
No off target data available for this crispr