ID: 940339624

View in Genome Browser
Species Human (GRCh38)
Location 2:152566577-152566599
Sequence ATAATCAGTCTTGCCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940339624_940339628 9 Left 940339624 2:152566577-152566599 CCTTCATGGGCAAGACTGATTAT No data
Right 940339628 2:152566609-152566631 TTGTAAAGGGTGCCTTGCCAAGG No data
940339624_940339627 -4 Left 940339624 2:152566577-152566599 CCTTCATGGGCAAGACTGATTAT No data
Right 940339627 2:152566596-152566618 TTATGGACTTAGTTTGTAAAGGG No data
940339624_940339626 -5 Left 940339624 2:152566577-152566599 CCTTCATGGGCAAGACTGATTAT No data
Right 940339626 2:152566595-152566617 ATTATGGACTTAGTTTGTAAAGG No data
940339624_940339630 16 Left 940339624 2:152566577-152566599 CCTTCATGGGCAAGACTGATTAT No data
Right 940339630 2:152566616-152566638 GGGTGCCTTGCCAAGGGTTAAGG No data
940339624_940339629 10 Left 940339624 2:152566577-152566599 CCTTCATGGGCAAGACTGATTAT No data
Right 940339629 2:152566610-152566632 TGTAAAGGGTGCCTTGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940339624 Original CRISPR ATAATCAGTCTTGCCCATGA AGG (reversed) Intronic