ID: 940341344

View in Genome Browser
Species Human (GRCh38)
Location 2:152584933-152584955
Sequence CCCCACCATAAGCAAAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940341344_940341353 25 Left 940341344 2:152584933-152584955 CCAAAGCTTTGCTTATGGTGGGG No data
Right 940341353 2:152584981-152585003 TCACTGAGCAAACACATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940341344 Original CRISPR CCCCACCATAAGCAAAGCTT TGG (reversed) Intronic
No off target data available for this crispr