ID: 940343414

View in Genome Browser
Species Human (GRCh38)
Location 2:152604496-152604518
Sequence GGTCTGCTTCTCAGGAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940343409_940343414 -1 Left 940343409 2:152604474-152604496 CCCTCAACCAAACATGAATCACG No data
Right 940343414 2:152604496-152604518 GGTCTGCTTCTCAGGAGAGCTGG No data
940343406_940343414 26 Left 940343406 2:152604447-152604469 CCTCATTTAGTTTAGCGTGTGCC No data
Right 940343414 2:152604496-152604518 GGTCTGCTTCTCAGGAGAGCTGG No data
940343407_940343414 5 Left 940343407 2:152604468-152604490 CCTAGCCCCTCAACCAAACATGA No data
Right 940343414 2:152604496-152604518 GGTCTGCTTCTCAGGAGAGCTGG No data
940343412_940343414 -8 Left 940343412 2:152604481-152604503 CCAAACATGAATCACGGTCTGCT No data
Right 940343414 2:152604496-152604518 GGTCTGCTTCTCAGGAGAGCTGG No data
940343408_940343414 0 Left 940343408 2:152604473-152604495 CCCCTCAACCAAACATGAATCAC No data
Right 940343414 2:152604496-152604518 GGTCTGCTTCTCAGGAGAGCTGG No data
940343410_940343414 -2 Left 940343410 2:152604475-152604497 CCTCAACCAAACATGAATCACGG No data
Right 940343414 2:152604496-152604518 GGTCTGCTTCTCAGGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940343414 Original CRISPR GGTCTGCTTCTCAGGAGAGC TGG Intronic
No off target data available for this crispr