ID: 940344505

View in Genome Browser
Species Human (GRCh38)
Location 2:152615424-152615446
Sequence GTCTGAACATTCCTGTCTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940344503_940344505 14 Left 940344503 2:152615387-152615409 CCCATGGACAGGATTAGCTGGTG No data
Right 940344505 2:152615424-152615446 GTCTGAACATTCCTGTCTTACGG No data
940344504_940344505 13 Left 940344504 2:152615388-152615410 CCATGGACAGGATTAGCTGGTGT No data
Right 940344505 2:152615424-152615446 GTCTGAACATTCCTGTCTTACGG No data
940344501_940344505 23 Left 940344501 2:152615378-152615400 CCACACAAACCCATGGACAGGAT No data
Right 940344505 2:152615424-152615446 GTCTGAACATTCCTGTCTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940344505 Original CRISPR GTCTGAACATTCCTGTCTTA CGG Intronic