ID: 940347221

View in Genome Browser
Species Human (GRCh38)
Location 2:152640231-152640253
Sequence TGCTCTTAGCCTCATTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940347221_940347222 13 Left 940347221 2:152640231-152640253 CCACTGGAATGAGGCTAAGAGCA 0: 1
1: 0
2: 3
3: 11
4: 148
Right 940347222 2:152640267-152640289 TATCCAAGCGTATAGACATCTGG No data
940347221_940347224 24 Left 940347221 2:152640231-152640253 CCACTGGAATGAGGCTAAGAGCA 0: 1
1: 0
2: 3
3: 11
4: 148
Right 940347224 2:152640278-152640300 ATAGACATCTGGAACTTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940347221 Original CRISPR TGCTCTTAGCCTCATTCCAG TGG (reversed) Intronic
903236050 1:21951452-21951474 GGCTCTTGGCCTCATTCAGGAGG + Intergenic
904339699 1:29826812-29826834 TTCTCTGAGCCTCATTCCTTAGG - Intergenic
909113772 1:71509301-71509323 TGCTCTTTCCCACATTGCAGAGG + Intronic
910496551 1:87835285-87835307 TGCTCCTAGCCTCACCACAGTGG - Intergenic
910838977 1:91543078-91543100 TACCATTAGCCTCATTTCAGAGG + Intergenic
912894729 1:113575102-113575124 TGCTCTTAGCTTCCTTGCATTGG + Intronic
913079175 1:115365886-115365908 GGCTCTTCGCCTCTTCCCAGAGG - Intergenic
917973178 1:180221593-180221615 TTCTCACAGCCACATTCCAGTGG + Intergenic
921501209 1:215905699-215905721 TGTTCTCAGCCTCATTCCCTAGG + Intronic
1064341701 10:14491527-14491549 ATCTCTTAGCCTCATGCTAGGGG + Intergenic
1069981312 10:72254854-72254876 TGCTCTGAGCCCAAGTCCAGTGG - Intergenic
1070275001 10:74997444-74997466 TGCTTTTAGCCCCATTCTATGGG + Intronic
1070679331 10:78437743-78437765 TGCTCTTAGACACATTGCACTGG - Intergenic
1072740722 10:97907560-97907582 TGGTCTTAGCCTGATTCAAGTGG + Intronic
1073592987 10:104773970-104773992 TGCATTTAGCACCATTCCAGGGG + Intronic
1073600807 10:104844300-104844322 TACTTTAAGCCTCATTCCTGTGG + Intronic
1074285772 10:112096876-112096898 TGGTCTTAACCTAATTCCACGGG - Intergenic
1075943080 10:126408067-126408089 TGCTCTTGAGCTCATGCCAGTGG - Intergenic
1079356891 11:19737221-19737243 TTCTCTAAGTCTCTTTCCAGTGG - Intronic
1080976857 11:37353420-37353442 TGCTTTTAGACTGAATCCAGAGG + Intergenic
1082968057 11:58988836-58988858 TGTTCTTAGCTTCATTTCAATGG + Intronic
1083171369 11:60925451-60925473 TGCTCTTAGCCTGACTCCCACGG - Intronic
1083685832 11:64374554-64374576 AGTACTTAGCCTCATTTCAGGGG + Intergenic
1083713526 11:64562871-64562893 TGCTCACAGCCTCAGCCCAGGGG - Intronic
1083883677 11:65560360-65560382 TGCTTTTATTCTCATTGCAGTGG + Intergenic
1087868834 11:103266453-103266475 TGCACTTAGTTCCATTCCAGTGG + Intronic
1089701474 11:120246724-120246746 TCTTCCTAGCCTAATTCCAGAGG - Intronic
1091063470 11:132486909-132486931 TGCTCTTGGCCTCTTTCCAGTGG - Intronic
1091175248 11:133552139-133552161 TACTCTTATCCTCATTTCACAGG + Intergenic
1093465487 12:19444117-19444139 TGCTCTTAGGTTAATTTCAGAGG + Intronic
1098362509 12:69668500-69668522 TGCCCTTAGCCTCAGTCAGGTGG + Intronic
1098523813 12:71463349-71463371 TTCTCTTAGCTTCAGTCGAGAGG + Intronic
1101439697 12:104694312-104694334 TGCTATTACCCACATTCCACAGG - Intronic
1103585722 12:121953925-121953947 TGCTCTTAGCAAACTTCCAGAGG + Intronic
1103993491 12:124814628-124814650 TTCACTTAGCCTGAGTCCAGTGG - Intronic
1105725071 13:23155278-23155300 TGCCCTTAGGATGATTCCAGAGG + Intergenic
1106482636 13:30148362-30148384 TTCTATTAGCCCCATTCCACAGG - Intergenic
1106576198 13:30977990-30978012 TGCTCTTTGCTGCATGCCAGAGG + Intergenic
1108806110 13:54158544-54158566 TGCTCTTACCTGCATTCCAAGGG - Intergenic
1109077263 13:57852391-57852413 TGCTCTTATCCTCATTGCCAAGG - Intergenic
1110674377 13:78222830-78222852 TTCTCTGGGCCTCATTCCATTGG + Intergenic
1114754305 14:25241922-25241944 TGCTCTTTGCCGTATTCCAAGGG - Intergenic
1114787757 14:25620738-25620760 TGATCAATGCCTCATTCCAGTGG - Intergenic
1117988376 14:61410596-61410618 TGCTCTTTGCCTCACTCCATTGG - Intronic
1118759126 14:68868228-68868250 AGCTCTTAGTCTCCTTGCAGTGG - Intergenic
1128852374 15:70972900-70972922 GGTTCTTAGCTTCATTCCATTGG + Intronic
1130157016 15:81359364-81359386 TGCTTTTATTGTCATTCCAGAGG - Exonic
1132764063 16:1525544-1525566 TGCTCTTAGACCCGTTCCCGGGG - Intronic
1133309197 16:4832019-4832041 TGCTCTTGGGCTCTTTTCAGAGG + Exonic
1136990786 16:35150216-35150238 TGCTCTTAGATTTATTTCAGTGG + Intergenic
1137321259 16:47385357-47385379 TGCTCTTATATGCATTCCAGTGG + Intronic
1143327548 17:6109436-6109458 TGCTCTGTGCCCAATTCCAGGGG - Intronic
1143720399 17:8805135-8805157 TGCTCTTACCCTCCTCCCAGTGG - Intronic
1144779087 17:17798949-17798971 AGCCCTTAGCTTCATCCCAGAGG - Intronic
1144886656 17:18467555-18467577 TGCTCTCAGCCCCACACCAGTGG - Intergenic
1145145556 17:20476753-20476775 TGCTCTCAGCCCCACACCAGTGG + Intergenic
1146595185 17:34162336-34162358 TGCCCTGAGCCTGATTCCTGAGG + Intronic
1147567189 17:41544981-41545003 TGTTATTAGCCTCATTTCAGAGG - Intergenic
1152422200 17:80199958-80199980 TGGGCTTCACCTCATTCCAGAGG + Intronic
1153030307 18:707768-707790 TGCTCTTATCCTTATTAAAGAGG + Intronic
1153062403 18:1007699-1007721 TGCCCTAAGTCTCATTCCACAGG + Intergenic
1154286232 18:13059583-13059605 TGCACTTAGCAACATGCCAGTGG + Intronic
1157351078 18:46886196-46886218 TGTGCTTAGCCACATTCCTGAGG + Intronic
1164437798 19:28247183-28247205 TCCTCTCAGCCTCATTCCTATGG - Intergenic
1164704912 19:30313034-30313056 TGCTCTGAGGCTCACCCCAGCGG - Intronic
927969623 2:27297256-27297278 AGCTCTTAGCCCAATTCCACAGG + Intronic
931285661 2:60829553-60829575 TGCTCTTGGCCACAGTCCTGAGG + Intergenic
933693095 2:85194760-85194782 TGCTCTGAATCTCATGCCAGGGG - Intronic
934113655 2:88764999-88765021 GGCGCTTAGCCTCATCCCTGTGG + Intergenic
935467047 2:103411066-103411088 TGCACTTAGCATCATTCTGGAGG - Intergenic
935846204 2:107168200-107168222 TGCTCTCAGCTTCATTCCCCTGG - Intergenic
940347221 2:152640231-152640253 TGCTCTTAGCCTCATTCCAGTGG - Intronic
940789917 2:158021153-158021175 TGCTCTTAACCTAGGTCCAGGGG - Intronic
941760013 2:169231910-169231932 TGCTCTTAGTGTCCTTCCAGAGG + Intronic
942183913 2:173406300-173406322 TGCTCTAAGCTCCATTGCAGAGG - Intergenic
944017359 2:195058424-195058446 TGCTTTTATCCACATTCCACTGG + Intergenic
946106303 2:217372956-217372978 TGCTCTTTGCCTCATGTCAAGGG + Intronic
947607428 2:231497006-231497028 TGCCCCTAACCTCATACCAGAGG + Intergenic
948623237 2:239250033-239250055 TGCGCTGGGCCTCCTTCCAGAGG - Intronic
1170699281 20:18688855-18688877 TGCTCTGATCCTCATTCCCTGGG + Intronic
1172989650 20:39024112-39024134 TGCTCTCAGCCTCATTCACCTGG - Intronic
1173118371 20:40268073-40268095 TAGTCTCAGCCTCATTCCACAGG + Intergenic
1174123375 20:48284044-48284066 TGCATTTAGCCTGAGTCCAGAGG - Intergenic
1174776243 20:53345706-53345728 GGCTCTTGGCCTCATTCTTGGGG - Intronic
1175498087 20:59429052-59429074 TGCTCTTTGCAGCATTCCTGAGG - Intergenic
1177153857 21:17482017-17482039 TGCTCTTAGACCCAGGCCAGTGG - Intergenic
1177631759 21:23737916-23737938 TGCTCTTGGTGTCTTTCCAGAGG + Intergenic
1179306270 21:40156169-40156191 GGCTCTCAGCCTCATCCCTGTGG - Intronic
1181182844 22:21079417-21079439 AGCTCTGGGCCTCCTTCCAGTGG + Intergenic
1183100119 22:35578742-35578764 TGCTCACTGCCTCATTCCAGGGG - Intergenic
1183356174 22:37360949-37360971 TGCTGTAAACCCCATTCCAGAGG - Intergenic
1183698193 22:39435016-39435038 TGTTCTTAGACACATCCCAGGGG - Intronic
1184126188 22:42489023-42489045 TGCACTCAGCCTCATGCCACGGG + Intergenic
949554624 3:5142373-5142395 TGCTCTTTCCCACATTGCAGAGG - Intronic
949554755 3:5143352-5143374 TGCTCTTTCCCACATTGCAGAGG - Intronic
951283294 3:20779328-20779350 TGGTTTTAGCCTCATTCCTAGGG - Intergenic
952690676 3:36201571-36201593 TGCTCTGTGCCTCATTTTAGGGG + Intergenic
953810973 3:46112599-46112621 TGCTCTTTCCCACATTGCAGAGG - Intergenic
955511225 3:59682410-59682432 TGCTCTCACTCTCAGTCCAGAGG + Intergenic
955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG + Intronic
958973274 3:100637518-100637540 AGCTCTTATCTACATTCCAGAGG - Intronic
960058486 3:113294514-113294536 TGGTGTTAGCCACATTACAGTGG - Intronic
960732365 3:120741481-120741503 TGCTCTTAGGCCAACTCCAGAGG + Intronic
961787734 3:129357757-129357779 TGTTCTCAGCCTCCTTCCACTGG - Intergenic
961907776 3:130280378-130280400 TGCTCTTTTCTTCATTCCACAGG + Intergenic
961955148 3:130793996-130794018 CACTCTTTCCCTCATTCCAGGGG - Intergenic
964479283 3:157126010-157126032 TACTCTTACCCACACTCCAGAGG + Intergenic
964824446 3:160809683-160809705 TGCTCTTACCATCTCTCCAGTGG + Intronic
965263179 3:166509677-166509699 GCCTTTTAACCTCATTCCAGAGG + Intergenic
965497964 3:169421082-169421104 TTCTCTGAACCTCATTCCAGTGG - Intronic
966154378 3:176900012-176900034 AGTTTTTAGCCTCATTCTAGTGG - Intergenic
967998088 3:195181656-195181678 TCCTCTCACCCTCATTTCAGAGG + Intronic
968274065 3:197426408-197426430 TGCTCTGAGCCCCATTCCAGGGG - Intergenic
970340539 4:15101928-15101950 TGTTCTTAGCCTCATTTCACAGG + Intergenic
970876013 4:20870894-20870916 TTCTCTAAGGCTCATTTCAGTGG + Intronic
971033460 4:22666790-22666812 TGATATGACCCTCATTCCAGAGG - Intergenic
975305791 4:72847438-72847460 GGTTCTTAGCTTCATTCCATTGG - Intergenic
975423847 4:74203221-74203243 AGCTCTTAGCCCAAATCCAGTGG + Intronic
975528573 4:75377501-75377523 TGCTCTTTGTTTCATTCCACAGG + Intergenic
977662410 4:99605914-99605936 TGCTTGTAGCCTAATTTCAGAGG + Intronic
979553465 4:122017725-122017747 TGCTCTCTGCTTCTTTCCAGTGG - Intergenic
982518388 4:156381588-156381610 TGCTCCTAGCTTAATACCAGGGG - Intergenic
985883552 5:2658488-2658510 TGCTCCTAGCCCCATCCCACGGG + Intergenic
986755130 5:10828639-10828661 TGCTCTTAGCCTCATTTGATAGG + Intergenic
986988394 5:13524537-13524559 TACTGTTAGCCACATTCCAGAGG + Intergenic
988264218 5:28928430-28928452 TGCGCTCAGCCTCATCCCTGTGG - Intergenic
988819195 5:34863767-34863789 TGCCCTTAACATCTTTCCAGTGG - Intronic
989726498 5:44593338-44593360 TGGTTTTAGGCTGATTCCAGTGG - Intergenic
992185461 5:74240119-74240141 TGCTCTTAACCTCATCTCATTGG - Intergenic
993765621 5:91853789-91853811 TATTCTTAGCCTCATTTCAGGGG + Intergenic
993835076 5:92810041-92810063 GGCTCTAAGCCTGACTCCAGGGG + Intergenic
995657360 5:114442068-114442090 TTCTGTTATCCTCACTCCAGTGG - Intronic
999586783 5:153098154-153098176 TTCTCTTACCCTCTTTCCAATGG - Intergenic
999628109 5:153541455-153541477 TGTTATTAGCCTCATTTTAGAGG + Intronic
1005137477 6:22586482-22586504 TGCTCTTAGCCTCATGCTCCAGG + Intergenic
1006106322 6:31719081-31719103 TGCACTGAGACTCATTCCATTGG - Exonic
1009456602 6:63864177-63864199 TGCTCTTACCATCAGTGCAGAGG + Exonic
1009793730 6:68438452-68438474 TGATTTCAGACTCATTCCAGTGG + Intergenic
1016820399 6:148341625-148341647 TGCTCTTATCCCCTTTCAAGTGG + Intronic
1017078464 6:150642498-150642520 TGGTCTTGGCAGCATTCCAGTGG - Intronic
1018842343 6:167526377-167526399 AGCTCCCAGCTTCATTCCAGTGG - Intergenic
1020822685 7:12989628-12989650 AGCTCTTGGCCTCATTCCCTAGG - Intergenic
1023972981 7:45005371-45005393 TGCTCTGAGCATCCTTTCAGAGG + Intronic
1026678550 7:72448300-72448322 TGCTCTTCCCCTCATCCCTGTGG - Intergenic
1027126380 7:75559575-75559597 AGCTCTTAGCCTCAGTCCAGAGG - Intronic
1030088903 7:105840185-105840207 TGCTCCTACACTCATGCCAGTGG - Intronic
1030934002 7:115561978-115562000 TGCTCTTTGCCTTACTTCAGTGG + Intergenic
1036671208 8:10789532-10789554 TCATCTTAGCCTCTGTCCAGAGG + Intronic
1037599305 8:20380498-20380520 AGGTCTTAGCATCATGCCAGAGG + Intergenic
1038179017 8:25209151-25209173 TGCTCTGAGCCTCCTTCAAATGG - Intronic
1043953337 8:86334309-86334331 TGTTCATAACCTCATTCAAGAGG - Intergenic
1046520185 8:115315226-115315248 TGCTTTTAACCTCATTCAGGTGG + Intergenic
1046876696 8:119262690-119262712 TCCATTTAGCATCATTCCAGCGG - Intergenic
1047287074 8:123496604-123496626 TGCTCTTGCCCTCATTCCTCTGG + Intergenic
1049929364 9:441265-441287 TGCTCTTCTCCTCTTTCCAAGGG + Exonic
1051386231 9:16511739-16511761 TACTCTTAACCTAACTCCAGGGG + Intronic
1053393075 9:37750230-37750252 AGCTCATAGCCACTTTCCAGTGG - Intronic
1186873887 X:13798302-13798324 TGTCCTTACCCTCAGTCCAGAGG - Intronic
1187307740 X:18111941-18111963 TTCACTTAGCATCATTCCATTGG - Intergenic
1189060263 X:37746162-37746184 TGCATTTAGCTGCATTCCAGGGG + Intronic
1191733542 X:64364369-64364391 TTCTGTAAGCTTCATTCCAGAGG - Intronic
1197305006 X:124830861-124830883 TGCTCTTAGCCCCCCTGCAGAGG - Intronic
1198530595 X:137547361-137547383 TGCTCTTAGGCCCAACCCAGAGG - Intergenic