ID: 940347476

View in Genome Browser
Species Human (GRCh38)
Location 2:152642601-152642623
Sequence GCTCCTGGTCTTGCTCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940347476_940347480 -7 Left 940347476 2:152642601-152642623 CCACCCTGAGCAAGACCAGGAGC No data
Right 940347480 2:152642617-152642639 CAGGAGCAGAGCTCCTTCCTAGG No data
940347476_940347482 7 Left 940347476 2:152642601-152642623 CCACCCTGAGCAAGACCAGGAGC No data
Right 940347482 2:152642631-152642653 CTTCCTAGGTAAGCACTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940347476 Original CRISPR GCTCCTGGTCTTGCTCAGGG TGG (reversed) Intronic
No off target data available for this crispr