ID: 940352056

View in Genome Browser
Species Human (GRCh38)
Location 2:152701836-152701858
Sequence TTTCTTGTTGCCGAGAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940352056_940352060 5 Left 940352056 2:152701836-152701858 CCCAGACTCTCGGCAACAAGAAA No data
Right 940352060 2:152701864-152701886 CAGGCCAGCAGCTTGGCAAAAGG No data
940352056_940352059 -2 Left 940352056 2:152701836-152701858 CCCAGACTCTCGGCAACAAGAAA No data
Right 940352059 2:152701857-152701879 AAAGATACAGGCCAGCAGCTTGG No data
940352056_940352062 30 Left 940352056 2:152701836-152701858 CCCAGACTCTCGGCAACAAGAAA No data
Right 940352062 2:152701889-152701911 TCTCACATGCTGCAGCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940352056 Original CRISPR TTTCTTGTTGCCGAGAGTCT GGG (reversed) Intronic
No off target data available for this crispr