ID: 940352057

View in Genome Browser
Species Human (GRCh38)
Location 2:152701837-152701859
Sequence TTTTCTTGTTGCCGAGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940352057_940352060 4 Left 940352057 2:152701837-152701859 CCAGACTCTCGGCAACAAGAAAA No data
Right 940352060 2:152701864-152701886 CAGGCCAGCAGCTTGGCAAAAGG No data
940352057_940352062 29 Left 940352057 2:152701837-152701859 CCAGACTCTCGGCAACAAGAAAA No data
Right 940352062 2:152701889-152701911 TCTCACATGCTGCAGCAACCAGG No data
940352057_940352059 -3 Left 940352057 2:152701837-152701859 CCAGACTCTCGGCAACAAGAAAA No data
Right 940352059 2:152701857-152701879 AAAGATACAGGCCAGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940352057 Original CRISPR TTTTCTTGTTGCCGAGAGTC TGG (reversed) Intronic
No off target data available for this crispr