ID: 940352061

View in Genome Browser
Species Human (GRCh38)
Location 2:152701868-152701890
Sequence GAATCCTTTTGCCAAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940352061_940352064 18 Left 940352061 2:152701868-152701890 CCAGCAGCTTGGCAAAAGGATTC No data
Right 940352064 2:152701909-152701931 AGGTAACTCTGCACAGACCAAGG No data
940352061_940352062 -2 Left 940352061 2:152701868-152701890 CCAGCAGCTTGGCAAAAGGATTC No data
Right 940352062 2:152701889-152701911 TCTCACATGCTGCAGCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940352061 Original CRISPR GAATCCTTTTGCCAAGCTGC TGG (reversed) Intronic
No off target data available for this crispr