ID: 940352062

View in Genome Browser
Species Human (GRCh38)
Location 2:152701889-152701911
Sequence TCTCACATGCTGCAGCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940352057_940352062 29 Left 940352057 2:152701837-152701859 CCAGACTCTCGGCAACAAGAAAA No data
Right 940352062 2:152701889-152701911 TCTCACATGCTGCAGCAACCAGG No data
940352056_940352062 30 Left 940352056 2:152701836-152701858 CCCAGACTCTCGGCAACAAGAAA No data
Right 940352062 2:152701889-152701911 TCTCACATGCTGCAGCAACCAGG No data
940352061_940352062 -2 Left 940352061 2:152701868-152701890 CCAGCAGCTTGGCAAAAGGATTC No data
Right 940352062 2:152701889-152701911 TCTCACATGCTGCAGCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940352062 Original CRISPR TCTCACATGCTGCAGCAACC AGG Intronic
No off target data available for this crispr