ID: 940352585

View in Genome Browser
Species Human (GRCh38)
Location 2:152705805-152705827
Sequence ACCTAGGAGAAACTCCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940352582_940352585 -3 Left 940352582 2:152705785-152705807 CCACACAAATGTCTGACCAGACC No data
Right 940352585 2:152705805-152705827 ACCTAGGAGAAACTCCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940352585 Original CRISPR ACCTAGGAGAAACTCCCTTC AGG Intronic
No off target data available for this crispr