ID: 940352806

View in Genome Browser
Species Human (GRCh38)
Location 2:152707638-152707660
Sequence CAGTCTGAGCAGAGCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940352806_940352809 -7 Left 940352806 2:152707638-152707660 CCTTCCTGGCTCTGCTCAGACTG No data
Right 940352809 2:152707654-152707676 CAGACTGGATATTAGTGAATCGG No data
940352806_940352811 8 Left 940352806 2:152707638-152707660 CCTTCCTGGCTCTGCTCAGACTG No data
Right 940352811 2:152707669-152707691 TGAATCGGGATCATTTAGTCTGG No data
940352806_940352810 -6 Left 940352806 2:152707638-152707660 CCTTCCTGGCTCTGCTCAGACTG No data
Right 940352810 2:152707655-152707677 AGACTGGATATTAGTGAATCGGG No data
940352806_940352812 13 Left 940352806 2:152707638-152707660 CCTTCCTGGCTCTGCTCAGACTG No data
Right 940352812 2:152707674-152707696 CGGGATCATTTAGTCTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940352806 Original CRISPR CAGTCTGAGCAGAGCCAGGA AGG (reversed) Intronic
No off target data available for this crispr