ID: 940357113

View in Genome Browser
Species Human (GRCh38)
Location 2:152755374-152755396
Sequence CAGGCCCGCCTGCAGTTATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940357108_940357113 6 Left 940357108 2:152755345-152755367 CCACCTCTTGTGGAGGGCCTGAC 0: 177
1: 128
2: 50
3: 45
4: 117
Right 940357113 2:152755374-152755396 CAGGCCCGCCTGCAGTTATCCGG No data
940357109_940357113 3 Left 940357109 2:152755348-152755370 CCTCTTGTGGAGGGCCTGACATC 0: 115
1: 129
2: 63
3: 41
4: 120
Right 940357113 2:152755374-152755396 CAGGCCCGCCTGCAGTTATCCGG No data
940357107_940357113 9 Left 940357107 2:152755342-152755364 CCTCCACCTCTTGTGGAGGGCCT 0: 178
1: 123
2: 43
3: 46
4: 138
Right 940357113 2:152755374-152755396 CAGGCCCGCCTGCAGTTATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940357113 Original CRISPR CAGGCCCGCCTGCAGTTATC CGG Intronic
No off target data available for this crispr