ID: 940357285

View in Genome Browser
Species Human (GRCh38)
Location 2:152757744-152757766
Sequence CAGTGTTCCCAGTGGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940357281_940357285 10 Left 940357281 2:152757711-152757733 CCTTTACCTAGCAGTAGTCTGTG No data
Right 940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG No data
940357282_940357285 4 Left 940357282 2:152757717-152757739 CCTAGCAGTAGTCTGTGACAATT No data
Right 940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940357285 Original CRISPR CAGTGTTCCCAGTGGGAATA TGG Intronic
No off target data available for this crispr