ID: 940365445

View in Genome Browser
Species Human (GRCh38)
Location 2:152843713-152843735
Sequence GAGGCACTCAACCTAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940365445_940365451 29 Left 940365445 2:152843713-152843735 CCTTGATCTAGGTTGAGTGCCTC No data
Right 940365451 2:152843765-152843787 TAGCCCATCCACCACCAGTTGGG No data
940365445_940365452 30 Left 940365445 2:152843713-152843735 CCTTGATCTAGGTTGAGTGCCTC No data
Right 940365452 2:152843766-152843788 AGCCCATCCACCACCAGTTGGGG No data
940365445_940365450 28 Left 940365445 2:152843713-152843735 CCTTGATCTAGGTTGAGTGCCTC No data
Right 940365450 2:152843764-152843786 GTAGCCCATCCACCACCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940365445 Original CRISPR GAGGCACTCAACCTAGATCA AGG (reversed) Intergenic
No off target data available for this crispr