ID: 940366372

View in Genome Browser
Species Human (GRCh38)
Location 2:152852658-152852680
Sequence TGGGATACACACCCCCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940366372_940366377 3 Left 940366372 2:152852658-152852680 CCCTGGTGGGGGTGTGTATCCCA No data
Right 940366377 2:152852684-152852706 GCAAACTCCCTTTCACAGTCTGG No data
940366372_940366378 4 Left 940366372 2:152852658-152852680 CCCTGGTGGGGGTGTGTATCCCA No data
Right 940366378 2:152852685-152852707 CAAACTCCCTTTCACAGTCTGGG No data
940366372_940366379 5 Left 940366372 2:152852658-152852680 CCCTGGTGGGGGTGTGTATCCCA No data
Right 940366379 2:152852686-152852708 AAACTCCCTTTCACAGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940366372 Original CRISPR TGGGATACACACCCCCACCA GGG (reversed) Intergenic
No off target data available for this crispr