ID: 940368430

View in Genome Browser
Species Human (GRCh38)
Location 2:152874717-152874739
Sequence GTCTTCACTGCTTCCTACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940368429_940368430 -7 Left 940368429 2:152874701-152874723 CCGGTCTGTGTTCACAGTCTTCA No data
Right 940368430 2:152874717-152874739 GTCTTCACTGCTTCCTACTGTGG No data
940368425_940368430 25 Left 940368425 2:152874669-152874691 CCGGGGGCACACAAATATTCAGA No data
Right 940368430 2:152874717-152874739 GTCTTCACTGCTTCCTACTGTGG No data
940368427_940368430 2 Left 940368427 2:152874692-152874714 CCATAGCACCCGGTCTGTGTTCA No data
Right 940368430 2:152874717-152874739 GTCTTCACTGCTTCCTACTGTGG No data
940368428_940368430 -6 Left 940368428 2:152874700-152874722 CCCGGTCTGTGTTCACAGTCTTC No data
Right 940368430 2:152874717-152874739 GTCTTCACTGCTTCCTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940368430 Original CRISPR GTCTTCACTGCTTCCTACTG TGG Intergenic
No off target data available for this crispr