ID: 940371295

View in Genome Browser
Species Human (GRCh38)
Location 2:152903953-152903975
Sequence TACTCCTCAGGTTAAAGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940371292_940371295 -4 Left 940371292 2:152903934-152903956 CCTGAGGATTACAGCAAGTTACT No data
Right 940371295 2:152903953-152903975 TACTCCTCAGGTTAAAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940371295 Original CRISPR TACTCCTCAGGTTAAAGGTA AGG Intergenic
No off target data available for this crispr