ID: 940373315

View in Genome Browser
Species Human (GRCh38)
Location 2:152925593-152925615
Sequence CCACATGCCCAGAGGGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940373315_940373320 12 Left 940373315 2:152925593-152925615 CCCTTGGCCCTCTGGGCATGTGG No data
Right 940373320 2:152925628-152925650 TCCCTATACACTCTGAAATTTGG No data
940373315_940373323 17 Left 940373315 2:152925593-152925615 CCCTTGGCCCTCTGGGCATGTGG No data
Right 940373323 2:152925633-152925655 ATACACTCTGAAATTTGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940373315 Original CRISPR CCACATGCCCAGAGGGCCAA GGG (reversed) Intergenic
No off target data available for this crispr