ID: 940377531

View in Genome Browser
Species Human (GRCh38)
Location 2:152972383-152972405
Sequence ATGCCCTTCTAGGACATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940377531_940377534 -6 Left 940377531 2:152972383-152972405 CCCTGGATGTCCTAGAAGGGCAT No data
Right 940377534 2:152972400-152972422 GGGCATCTCCATCCCACTCAAGG No data
940377531_940377538 12 Left 940377531 2:152972383-152972405 CCCTGGATGTCCTAGAAGGGCAT No data
Right 940377538 2:152972418-152972440 CAAGGTGATTAAAAACCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940377531 Original CRISPR ATGCCCTTCTAGGACATCCA GGG (reversed) Intergenic
No off target data available for this crispr