ID: 940396920

View in Genome Browser
Species Human (GRCh38)
Location 2:153200180-153200202
Sequence GAGGATAAACTGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940396914_940396920 16 Left 940396914 2:153200141-153200163 CCTCACCCTTGAGACTGAAATCA No data
Right 940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG No data
940396916_940396920 11 Left 940396916 2:153200146-153200168 CCCTTGAGACTGAAATCAGGTAT No data
Right 940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG No data
940396917_940396920 10 Left 940396917 2:153200147-153200169 CCTTGAGACTGAAATCAGGTATC No data
Right 940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG No data
940396913_940396920 30 Left 940396913 2:153200127-153200149 CCTCGGCTTCTGAACCTCACCCT No data
Right 940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940396920 Original CRISPR GAGGATAAACTGAAGCAGGA AGG Intergenic
No off target data available for this crispr