ID: 940400488

View in Genome Browser
Species Human (GRCh38)
Location 2:153243111-153243133
Sequence GGGATGTGTGCATATCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940400488_940400498 16 Left 940400488 2:153243111-153243133 CCTGGGTGATATGCACACATCCC No data
Right 940400498 2:153243150-153243172 ATGAGACACCAATGGGTGATGGG No data
940400488_940400497 15 Left 940400488 2:153243111-153243133 CCTGGGTGATATGCACACATCCC No data
Right 940400497 2:153243149-153243171 GATGAGACACCAATGGGTGATGG No data
940400488_940400496 9 Left 940400488 2:153243111-153243133 CCTGGGTGATATGCACACATCCC No data
Right 940400496 2:153243143-153243165 CTGAGAGATGAGACACCAATGGG No data
940400488_940400495 8 Left 940400488 2:153243111-153243133 CCTGGGTGATATGCACACATCCC No data
Right 940400495 2:153243142-153243164 ACTGAGAGATGAGACACCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940400488 Original CRISPR GGGATGTGTGCATATCACCC AGG (reversed) Intergenic
No off target data available for this crispr