ID: 940400495

View in Genome Browser
Species Human (GRCh38)
Location 2:153243142-153243164
Sequence ACTGAGAGATGAGACACCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940400488_940400495 8 Left 940400488 2:153243111-153243133 CCTGGGTGATATGCACACATCCC No data
Right 940400495 2:153243142-153243164 ACTGAGAGATGAGACACCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940400495 Original CRISPR ACTGAGAGATGAGACACCAA TGG Intergenic
No off target data available for this crispr